perros
ACCESO USUARIOS |Email Contraseña No recuerdo mi contraseña Inciar sesión en Perros.com|No estás registrado? Regístrate Registrate en Perros.com
Foro de La Terraza
La Terraza

Hablemos de genética

Moderadores: Damzel, sandrarf
Usuario Titulo: Hablemos de genética

Farag

¡Adicto Total!
PuntuaciónPuntuaciónPuntuaciónPuntuaciónPuntuación
3378 mensajes
Sin foto
0 Albumes (0 fotos)
0 perros (0 fotos)

Sexo: Hombre
Edad: 81 años
Provincia: Svalbard
Publicado: domingo 07 de octubre de 2012, 02:02
Abro este tema para que todos a los que nos interese la genética podamos hablar sobre ella expresar nuestras dudas para que otros usuarios con mas conocimientos nos puedan ayudar.
Denunciar mensaje Citar
Usuario Titulo: Hablemos de genética

Ukyo

¡Adicto Total!
PuntuaciónPuntuaciónPuntuaciónPuntuaciónPuntuación
9870 mensajes
Ukyo
0 Albumes (0 fotos)
0 perros (0 fotos)

Sexo: Mujer
Edad: 32 años
Provincia: Sachsen-Anhalt
Publicado: domingo 07 de octubre de 2012, 02:06
Yo respondo para suscribirme al tema, así me entero de que hay respuestas nuevas. A quien tenga una duda de biología molecular, celular o genética (que suelen estar bastante relacionadas) intentaré hacer lo que esté en mi mano para resolvérsela.
Denunciar mensaje Citar
Usuario Titulo: Hablemos de genética

Farag

¡Adicto Total!
PuntuaciónPuntuaciónPuntuaciónPuntuaciónPuntuación
3378 mensajes
Sin foto
0 Albumes (0 fotos)
0 perros (0 fotos)

Sexo: Hombre
Edad: 81 años
Provincia: Svalbard
Publicado: domingo 07 de octubre de 2012, 02:08
Asi, para empezar como fluye la información genética desde el ADN?
Denunciar mensaje Citar
Usuario Titulo: Hablemos de genética

Ukyo

¡Adicto Total!
PuntuaciónPuntuaciónPuntuaciónPuntuaciónPuntuación
9870 mensajes
Ukyo
0 Albumes (0 fotos)
0 perros (0 fotos)

Sexo: Mujer
Edad: 32 años
Provincia: Sachsen-Anhalt
Publicado: domingo 07 de octubre de 2012, 02:13
Asi, para empezar como fluye la información genética desde el ADN?
Creo que uno de los problemas principales cuando en biología de bachillerato meten "de golpe" la replicación, la transcripción y la traducción del DNA es que la gente no sabe qué es el DNA. Es decir, sí "donde están los genes", "la información genética del individuo"... vale. Pero cuando se comprende la estructura molecular del DNA, en mi opinión, resulta más sencillo.Siempre te dirán que el DNA a partir de un proceso llamado transcripción da lugar a los distintos RNAs y que de esos RNAs, el mensajero (mRNA) a partir de un proceso llamado traducción da lugar a las proteínas. Pero la mayoría de la gente a la que le dicen esto no sabe qué es un gen, ni un cromosoma, ni "el DNA", ni el RNA ni entiende los procesos de transcripción y traducción molecularmente.Si no me equivoco, este es tu caso, ¿verdad?
Denunciar mensaje Citar
Usuario Titulo: Hablemos de genética

Farag

¡Adicto Total!
PuntuaciónPuntuaciónPuntuaciónPuntuaciónPuntuación
3378 mensajes
Sin foto
0 Albumes (0 fotos)
0 perros (0 fotos)

Sexo: Hombre
Edad: 81 años
Provincia: Svalbard
Publicado: domingo 07 de octubre de 2012, 02:15
Si no me equivoco, este es tu caso, ¿verdad?  
Te equivocas. Pero te cuento por privado
Denunciar mensaje Citar
Usuario Titulo: Hablemos de genética

Ukyo

¡Adicto Total!
PuntuaciónPuntuaciónPuntuaciónPuntuaciónPuntuación
9870 mensajes
Ukyo
0 Albumes (0 fotos)
0 perros (0 fotos)

Sexo: Mujer
Edad: 32 años
Provincia: Sachsen-Anhalt
Publicado: domingo 07 de octubre de 2012, 02:33
Bueno, para tu caso, creo que esto puede servirte, lo escribí en otra web en la que escribo también:-----------------------LOS GENES NO CODIFICAN CARACTERES, CODIFICAN PROTEÍNAS.¿Por qué es importante entender esto?Mucha gente tiene la tendencia a pensar que un gen da lugar de forma invariable a un carácter. Es decir, que existe un gen de los ojos azules, un gen del pelo rubio, un gen de los brazos largos, un gen de la piel oscura… etc.Esto es absoluta y totalmente erróneo, y deriva del escasísimo conocimiento genético que tiene la población de hoy en día, cuyos conocimientos se derivan de la genética mendeliana donde se vieron estos sucesos. Los experimentos de Mendel explican la parte más sencilla de la genética, pero se quedan cortos (cortísimos) para hablar de temas más serios, como las enfermedades hereditarias de los perros, por ejemplo.Por eso es importante que quede BIEN CLARO que los genes NO DAN LUGAR a caracteres concretos, sino a proteínas. Y es la interacción de las proteínas entre ellas (o la carencia de esta interacción, en algunos casos) lo que da lugar a la mayoría de los caracteres genéticos.Para el que ande pez, un carácter es cualquier cosa que os queráis proponer. Desde el color de ojos, pasando por la altura de una persona, hasta la longitud del hueso de la mandíbula inferior o el color de la planta del pie. Todo eso está determinado, en parte por su BACKGROUND genético y en parte de forma ambiental (es decir, por el desarrollo embrionario, entre otros).Entonces, ¿qué es un gen molecularmente hablando?Una mirada hacia atrás: el DNA, ese gran desconocido.Si atendemos al DOGMA CENTRAL DE LA BIOLOGÍA MOLECULAR, propuesto por Watson y Crick a raíz de su descubrimiento de la estructura molecular del DNA (estudios por los que obtendrían el premio Nobel) se propone un flujo unidireccional de la información genética (que hoy día se ha demostrado que tiene excepciones pero que nos sirve para lo que queremos explicar).La información genética de un individuo está "guardada" en su DNA. El DNA es simplemente una molécula en forma de doble hélice formada por unidades que se emparejan con la otra hebra de manera concreta. Tenemos 4 unidades (nucleótidos) distintos, Adenina (A), Guanina (G), Citosina (C) y Timina (T). Adenina siempre empareja con Timina a través de dos puentes de hidrógeno (un tipo de enlace químico) y Citosina lo hace con Guanina a través de tres puentes de hidrógeno. Gracias a esto se forma una estructura de doble hélice levógira (que gira a izquierdas) en la que se concentra toda la información genética de un individuo.¿Cómo es eso posible?Es sencillo, y es la base del DOGMA CENTRAL DE LA BIOLOGÍA MOLECULAR. La información contenida en el DNA está en forma de CÓDIGO, de modo que cada una de las dos hebras que forman la molécula de DNA tiene un código "de letras" formado por sus nucleótidos. Por ejemplo, el código de una hebra de DNA puede ser:AAAGCGAGTAGTGGCCATGACLos sistemas celulares saben interpretar este código y producir otras moléculas a partir de él, así es que a partir del DNA por un proceso que se conoce como TRANSCRIPCIÓN, y a través de unas enzimas (proteínas catalíticas) concretas obtenemos los distintos tipos de RNA (ribosómico, de transferencia y mensajero).¿Interpretamos el código? Fabricando proteínas.Dejaremos de lado dos de los tipos de RNA y nos interesaremos por el RNA mensajero, pues es el que principalmente dará lugar a las proteínas de los organismos.Así es que a través del proceso de TRANSCRIPCIÓN el ejemplo de código anterior puede TRANSCRIBIRSE a RNA. El RNA se diferencia del DNA básicamente en un sustituyente (una ramificación) de la ribosa que forma el nucleótido y en que no existe el nucleótido Timina, en su lugar existe el Uracilo (U), que empareja con la Adenina igual que la Timina (con dos puentes de hidrógeno). Así si nosotros fuéramos una enzima (concretamente, una RNA polimerasa), TRANSCRIBIRÍAMOS el código de la hebra anterior a RNA mensajero así:UUUCGCUCACCGGUACUGSimplemente:Donde hay A ponemos U (pues la adenina empareja con uracilo).Donde hay T ponemos A (pues la timina empareja con la adenina).Donde hay G ponemos C (pues la guanina empareja con la citosina).Donde hay C ponemos G (pues la citosina empareja con la guanina).En la imagen se esquematiza el proceso de la transcripción. Las líneas azules representan las dos cadenas del DNA, que se mantienen superenrrolladas en condiciones normales. Durante la transcripción, mediante otras enzimas y un proceso molecular complejo se libera la tensión en la zona de interés (donde está el gen que queremos transcribir) para garantizar el acceso de la RNA polimerasa (pelota azul). La línea naranja representa el RNA mensajero que la RNA polimerasa se está encargando de generar. Como se puede observar, sólo una cadena del DNA se utiliza para la transcripción (cadena molde), la otra no se utiliza (cadena inactiva). El uso de una u otra, y en una dirección u otra dependerá de qué gen (o genes) esté la célula interesada en transcribir.Continuemos, ya tenemos el RNA mensajero… ¿De dónde sacamos la proteína?El proceso molecular de transmisión de la información génica no concluye con la transcripción, el RNA mensajero tiene que ser leído por la maquinaria celular para producir otras moléculas: las PROTEÍNAS. Este proceso se denomina TRADUCCIÓN, y se efectúa a través de la actuación de la maquinaria ribosomal de la célula (es decir, de los orgánulos celulares conocidos como “ribosomas”). La imagen muestra la estructura de un ribosoma. Está formado por dos subunidades que se conocen como “subunidad grande” y “subunidad pequeña”. Durante el proceso de traducción el ribosoma “lee” la hebra de RNA mensajero formada durante la traducción y construye una cadena peptídico a partir de ella, que dará lugar a una proteína.Así, el RNA mensajero es leído y se produce la proteína mediante el uso de los aminoácidos, unas moléculas peptídicas que producimos en el cuerpo o ingerimos con la dieta (aminoácidos esenciales). Así, mediante la maquinaria celular un RNA mensajero es convertido a proteína mediante la interpretación del código genético (que es universal):La imagen superior esquematiza el código genético. Este se lee en “codones”, o lo que es lo mismo “en grupos de tres nucleótidos”. Como se ve en la imagen, los distintos codones dan lugar a un aminoácido concreto. Por ejemplo: UUU y UUC codifican el aminoácido Fen (fenilalanina).Siguiendo el ejemplo anterior, nuestra hebra era:UUUCGCUCACCGGUACUGLa separamos en grupos de tres codones:UUU // CGC // UCA // CCG // GUA // CUGY miramos qué aminoácido codifican con el código genético. Obteniendo:Fen – Arg – Ser – Pro – Val – LeuLos aminoácidos que aparecen, por si no conocéis la abreviatura son: fenialanina (Fen), arginina (Arg), serina (Ser), prolina (Pro), valina (Val) y leucina (Leu).Con esto la célula tendría su PROTEÍNA CONSTRUIDA (interpretada desde su código genético), que mediante los mecanismos apropiados (con ayuda de otras proteínas llamadas chaperonas) se plegaría para tener la estructura correcta y ejercer su función en la célula (por ejemplo, puede ser una proteína que forme un canal de calcio dimérico que se abra al unir su ligando liberando el calcio intracelular).----------------------------Creo que este texto puede responder tus dudas, si no entiendes algo, o tienes más preguntas, no te cortes: pregunta.
Denunciar mensaje Citar
Usuario Titulo: Hablemos de genética

patrinas

¡Adicto Total!
PuntuaciónPuntuaciónPuntuaciónPuntuaciónPuntuación
5187 mensajes
patrinas
1 Albumes (110 fotos)
6 perros (5 fotos)

Sexo: Mujer
Edad: 23 años
Provincia: Málaga
Publicado: domingo 07 de octubre de 2012, 02:42
pero creo haber visto que los palos esos era la cromatida, entonces no lo entendi bien y eso no es asi o como?
Denunciar mensaje Citar
Usuario Titulo: Hablemos de genética

Ukyo

¡Adicto Total!
PuntuaciónPuntuaciónPuntuaciónPuntuaciónPuntuación
9870 mensajes
Ukyo
0 Albumes (0 fotos)
0 perros (0 fotos)

Sexo: Mujer
Edad: 32 años
Provincia: Sachsen-Anhalt
Publicado: domingo 07 de octubre de 2012, 02:49
pero creo haber visto que los palos esos era la cromatida, entonces no lo entendi bien y eso no es asi o como?
Ahí no sale ninguna cromátida. La cromátida sólo ocurre durante la metafase de la mitosis, y se trata de DNA condensado y duplicado, preparado para ser repartido en células hijas. Los procesos de transcripción y traducción no ocurren en células que se están dividiendo (en mitosis) si no en células en reposo (en periodo G0 o G1).La cromátida es una organización superior del DNA, aquí estás viendo un proceso que ocurre a un nivel más fundamental.
Denunciar mensaje Citar
Usuario Titulo: Hablemos de genética

patrinas

¡Adicto Total!
PuntuaciónPuntuaciónPuntuaciónPuntuaciónPuntuación
5187 mensajes
patrinas
1 Albumes (110 fotos)
6 perros (5 fotos)

Sexo: Mujer
Edad: 23 años
Provincia: Málaga
Publicado: domingo 07 de octubre de 2012, 03:08
pero creo haber visto que los palos esos era la cromatida, entonces no lo entendi bien y eso no es asi o como?
Ahí no sale ninguna cromátida. La cromátida sólo ocurre durante la metafase de la mitosis, y se trata de DNA condensado y duplicado, preparado para ser repartido en células hijas. Los procesos de transcripción y traducción no ocurren en células que se están dividiendo (en mitosis) si no en células en reposo (en periodo G0 o G1).La cromátida es una organización superior del DNA, aquí estás viendo un proceso que ocurre a un nivel más fundamental.
de momento me lo podrias resumir un poco que casi no lo entiendo, hace apenas dias que di la mitosis, lo que entiendo es que lo que yo digo es correcto pero es otro tipo de adn, entonces lo que tu dices es otro tipo que es lo que es la genetica en si o como?
Denunciar mensaje Citar
Usuario Titulo: Hablemos de genética

Ukyo

¡Adicto Total!
PuntuaciónPuntuaciónPuntuaciónPuntuaciónPuntuación
9870 mensajes
Ukyo
0 Albumes (0 fotos)
0 perros (0 fotos)

Sexo: Mujer
Edad: 32 años
Provincia: Sachsen-Anhalt
Publicado: domingo 07 de octubre de 2012, 03:14
No, lo que pasa es que el proceso que tú estás viendo (mitosis) ocurre en otras circunstancias (tras la replicación del DNA), y estamos hablando de cosas distintas. Te lo voy a explicar con ropa, a ver si lo entiendes. Lo que estás viendo en las imágenes de arriba son los hilos que forman parte de una pieza de ropa. Tú me estás preguntando si es la manga de la camiseta (cromátida) y yo te estoy diciendo es un nivel de organización inferior (hilo), más fundamental.
Denunciar mensaje Citar
Usuario Titulo: Hablemos de genética

patrinas

¡Adicto Total!
PuntuaciónPuntuaciónPuntuaciónPuntuaciónPuntuación
5187 mensajes
patrinas
1 Albumes (110 fotos)
6 perros (5 fotos)

Sexo: Mujer
Edad: 23 años
Provincia: Málaga
Publicado: domingo 07 de octubre de 2012, 03:19
No, lo que pasa es que el proceso que tú estás viendo (mitosis) ocurre en otras circunstancias (tras la replicación del DNA), y estamos hablando de cosas distintas. Te lo voy a explicar con ropa, a ver si lo entiendes. Lo que estás viendo en las imágenes de arriba son los hilos que forman parte de una pieza de ropa. Tú me estás preguntando si es la manga de la camiseta (cromátida) y yo te estoy diciendo es un nivel de organización inferior (hilo), más fundamental.
tu me estas diciendo que la cromatida esta formada por lo que tu dices? y entonces la cromatidas que tu dices forma un adn que forma la cromatida, y esta pues esta dispersa por en nucleo y forma otra red de adn que es menos importante que la primera que forma la cromatida?la verdad es que algunas partes es complicado.
Denunciar mensaje Citar
Usuario Titulo: Hablemos de genética

Ukyo

¡Adicto Total!
PuntuaciónPuntuaciónPuntuaciónPuntuaciónPuntuación
9870 mensajes
Ukyo
0 Albumes (0 fotos)
0 perros (0 fotos)

Sexo: Mujer
Edad: 32 años
Provincia: Sachsen-Anhalt
Publicado: domingo 07 de octubre de 2012, 03:25
La cromátida es simplemente un nivel de organización del DNA.Yo estoy hablando de procesos que ocurren en los primeros niveles de la imagen, y tú del último (en la X del final, una de las aspas es una cromátida).
Denunciar mensaje Citar
Usuario Titulo: Hablemos de genética

patrinas

¡Adicto Total!
PuntuaciónPuntuaciónPuntuaciónPuntuaciónPuntuación
5187 mensajes
patrinas
1 Albumes (110 fotos)
6 perros (5 fotos)

Sexo: Mujer
Edad: 23 años
Provincia: Málaga
Publicado: domingo 07 de octubre de 2012, 03:27
a vale, en tu expplicacion de la ropa no seria entonces hilo, seria fibrilla del hilo,bueno me voy a la cama que creo que me esta subiendo la fiebre, maldita gripe, me siento fatal.
Denunciar mensaje Citar
Usuario Titulo: Hablemos de genética

ringgo

Quiero ser Adicto
PuntuaciónPuntuaciónPuntuaciónPuntuaciónPuntuación
45 mensajes
Sin foto
0 Albumes (0 fotos)
1 perros (0 fotos)

Sexo: Hombre
Edad: 32 años
Provincia: Madrid
Publicado: miércoles 17 de octubre de 2012, 03:51
muy buen articulo, me permito el lujo de añadirte ( si cabe algo) las superestructuras del adnEmpezamos contando que es un nucleosoma. Este esta formado por un nucleo ( formado a su vez por 8 proteinas basicas 2 moleculas de H2a 2 de h2b,2 de H3 y 2 de H4) unido a un espaciador ( proteina basica H1). Este nucleosoma se unen y enrollan, formando el llamado solenoide, el cual tambien se puede enrollar formando el supersolenoide, el cual se enrolla formando los cromosomas.A ver si lo puedo explicar un poquito. el cromosoma que todos conocemos, como la forma X, esta formado por un centromero (une las 4 "patas") y 2 cromatidas. Pero que pasa, que esta "x" es solo cuando se produce MITOSIS Y MEIOSIS ( si no sabes las diferencias dilo), es decir, cuando es visible,y para ellos han de condensarse ( siendo metafase la fase en la que mas se condensan, si no me equivoco).Tambien me gustaria añadir, que el ADN eucariotico ( el nuestro, es del los seres vivos complejos) posee muchisimas pero muchisima informacion no valida, las llamadas cadenas moderadamente o altamente repetitivas.Por ultimo decir que el codigo genetico tiene 3 normas que siempre se cumple,son su universalidad ( el mismo triplete codifica para el mismo aminoacido sea cual sea la especia) es no imbrincado ( queriendo decir un nucleotido solo pertenece a un triplete )y por ultimo es degenerado ( un aminoacido puede estar codificado por distintos tripletes ) ya que solo existen 20 aminoacidos, y 64 tripletes distintos, ya que si no fuera degenerado los 4 nucleotidos elevados a 64 tripletes distintos...calculad que daria.LA genetica personalmente me gusta, pero me gusta porque todo, y cuando digo todo es todo, se basa en la genetica. Desde beneficios a mutaciones (benignas,malignas) pasando por todo tipo de enfermedades que puede hacer un cambio de nucleotido ( todos los canceres proceden de mutuaciones)Espero te haya ayudado un poquito mas, y sobre todo , si necesitas algo de genetica no dudes en preguntar, por muy tonteria que sea, ami me costo mucho entenderla! un saludo
Denunciar mensaje Citar
Usuario Titulo: Hablemos de genética

zorgin

Antiguo Usuario
Publicado: miércoles 17 de octubre de 2012, 08:46
Muchas gracias por el articulo, Estoy ahora estudiando justo el ADN en psicobiologia, y añado el articulo a mis apuntes, me ha encantado lo de los hilos y la camiseta   muy buen ejemplo.Yo estoy en pañales en genetica, y en el libro tambien se habla de la informacion no valida, cuando lo he leido me plantee, que quizas no es que no sea valida o no codifique nada sino que no hemos descubierto su funcion ya que observando a la "madre naturaleza"  podriamos decir que es una ahorradora de recursos.Gracias de nuevo por el articulo, en cuanto tenga dudas (seguro que en cuanto retome el estudio en plan mas serio) las pregunto.
Denunciar mensaje Citar
Usuario Titulo: Hablemos de genética

Ukyo

¡Adicto Total!
PuntuaciónPuntuaciónPuntuaciónPuntuaciónPuntuación
9870 mensajes
Ukyo
0 Albumes (0 fotos)
0 perros (0 fotos)

Sexo: Mujer
Edad: 32 años
Provincia: Sachsen-Anhalt
Publicado: miércoles 17 de octubre de 2012, 14:33
(...) Pero que pasa, que esta "x" es solo cuando se produce MITOSIS Y MEIOSIS ( si no sabes las diferencias dilo) (...)
¿Esta pregunta es a mí?
Muchas gracias por el articulo, Estoy ahora estudiando justo el ADN en psicobiologia, y añado el articulo a mis apuntes, me ha encantado lo de los hilos y la camiseta   muy buen ejemplo.Yo estoy en pañales en genetica, y en el libro tambien se habla de la informacion no valida, cuando lo he leido me plantee, que quizas no es que no sea valida o no codifique nada sino que no hemos descubierto su funcion ya que observando a la "madre naturaleza"  podriamos decir que es una ahorradora de recursos.Gracias de nuevo por el articulo, en cuanto tenga dudas (seguro que en cuanto retome el estudio en plan mas serio) las pregunto.
No, no. Realmente esa información es no codificante. Eso lo saben seguro porque cuando analizan la estructura tiene características inequívocas. Por ejemplo, no tiene promotores ni enhancers (es decir, no recluta al complejo de la transcripción, y por lo tanto, no codifica nada). Es repetitva (esto es típico sobre todo de los telómeros, las "puntas" finales del cromosoma, porque siempre que se replica en una de las dos cadenas es obligatorio perder un cachito chiquitín, y por lo tanto los telómeros tienen información basura y redundante para impedir que se pierda información codificante o importante; además esto está relacionado con la vida media de la célula). Está condensada en heterocromatina, es decir, está fuertemente empaquetada y los complejos de transcripción no tienen acceso. Eso es típico de regiones inertes o sin información.De todos modos, analizando la información que se encuentra en estos "cementerios", mucha es de virus que han afectado a nuestra especie, genes duplicados que perdieron su función, transposones (regiones autónomas que catalizan su escisión e integración en partes del genoma de la especie...).Un saludo.
Denunciar mensaje Citar
Usuario Titulo: Hablemos de genética

ringgo

Quiero ser Adicto
PuntuaciónPuntuaciónPuntuaciónPuntuaciónPuntuación
45 mensajes
Sin foto
0 Albumes (0 fotos)
1 perros (0 fotos)

Sexo: Hombre
Edad: 32 años
Provincia: Madrid
Publicado: miércoles 17 de octubre de 2012, 16:11
(...) Pero que pasa, que esta "x" es solo cuando se produce MITOSIS Y MEIOSIS ( si no sabes las diferencias dilo) (...)
¿Esta pregunta es a mí? :?no no, en absoluto, si leyendote se sabe que de genetica andas bien, era para el que abrio el tema. La verdad es que la funcion no se tiene muy claro, perio piensa que en las celulas procariotas, a parte de que el adn esta disperso y tiene otra estructura, no tiene esas cadenas altamente repetitivas, si no que todo el adn es unico, osea codificante (genes estructurales)un saludo
Denunciar mensaje Citar


conectados
Usuarios conectados
Tenemos 449 usuarios conectados. 448 invitados y 1 miembro/s: CyC2009,

Enlaces link Razas de perros|Foro de Perros|Venta perros|Adiestramiento perros|Adopciones de perros
Razas destacadas link Pastor alemán|Bulldog|Bull terrier|Yorkshire|Boxer|San bernardo|Schnauzer|Golden Retriever|Doberman|Labrador Retriever
Copyright © 1997-2015 Perros.com - Todos los derechos reservados
Publicidad en Perros.com| |Aviso Legal|Política de privacidad|Condiciones de uso